| Sequence ID: | MOBIL9484-19.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | RibbonF1 (TTTCAACWAATCATAARGATATTGG) | Primers Reverse: | RibbonR1 (TAAACTTCRGGRTGWCCAAARAAYCV) |
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| TTTTTTTTTTGGTTATGCCCGTAATGATTGGGGGATTTGGAAATTGATTGGTTCCTCTGATGTTGGGGGCGCCTGATATGGCTTTTCCTCGTATAAATAATATAAGATTTTGGTTGTTGCCTCCATCTTTAATATTGTTATTGGGATCTGCGGCTGTTGAGGGGGGTGTTGGTACTGGTTGGACAGTTTATCCACCCTTATCGGGCAATGTGGCGCACGGGGGTGGATCGGTTGATCTTGCTATTTTTTCTCTTCATTTGGCTGGTGTTTCTTCTATTTTAGGTGCTATTAATTTTATCACTACGGTCATTAATATGCGATGACGAGGGCTTCAATTTGAGCGTTTACCTTTATTTGTATGGTCTGTTAAAATTACTGCTATTTTGTTATTGTTATCGTTACCAGTTTTGGCTGGAGCGATTACTATGCTTCTTACTGATCGTAACTTTAACACTTCT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 458 bp | ||
| Sequence Upload Date: | 2019-06-01 | ||
| Specimen Depository: | Centre for Biodiversity Genomics, Informatics Department |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | LifeScanner User |
| Collectors: | Susan Wise-Eagle |
| Specimen Identification: |
| Process ID: | MOBIL9484-19 | Sample ID: | BOLD-3O6U17SL0 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2019-04-29 | Museum ID: | ||||
| Collection Code: | Field ID: | BOLD-3O6U17SL0 | ||||
| Deposited In: | Centre for Biodiversity Genomics, Informatics Department | |||||
| Associated Datasets: | DS-LSPUB | LifeScanner Samples Requested for Public Release | |||||
| Specimen Linkout: | ||||||
| Checksum: | 4f3bce735211a764ac671414b33357b8 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Nemertea | Tribe: | |
| Class: | Pilidiophora | Genus: | Maculaura |
| Order: | Heteronemertea | Species: | Maculaura cerebrosa |
| Family: | Lineidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAP1201 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | other: I think it`s Tubulanus polymorphus, though it is more pale flesh-colored than red | ||
| Country/Ocean: | United States (US) | Collection Date Start: | |
|---|---|---|---|
| Province/State: | Alaska | Collection Date End: | |
| Region/County: | Wrangell | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Elevation: | ||
| Habitat: | marine | Elevation Accuracy: | |
| Latitude: | 56.356033 | Depth: | |
| Longitude: | -132.35263 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Susan Wise-Eagle | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Northern_Pacific_Alaskan_coastal_forests |
http://portal.boldsystems.org/record/MOBIL9484-19 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AMOBIL9484-19&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AMOBIL9484-19&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfL1d_L0sTSxMNE1tLTOyczNLElNAQDRCwuH?length=1
© 2024 BOLDSYSTEMS