Sequence ID: | MOBIL9484-19.COI-5P | GenBank Accession: | |
---|---|---|---|
Primers Forward: | RibbonF1 (TTTCAACWAATCATAARGATATTGG) | Primers Reverse: | RibbonR1 (TAAACTTCRGGRTGWCCAAARAAYCV) |
Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
TTTTTTTTTTGGTTATGCCCGTAATGATTGGGGGATTTGGAAATTGATTGGTTCCTCTGATGTTGGGGGCGCCTGATATGGCTTTTCCTCGTATAAATAATATAAGATTTTGGTTGTTGCCTCCATCTTTAATATTGTTATTGGGATCTGCGGCTGTTGAGGGGGGTGTTGGTACTGGTTGGACAGTTTATCCACCCTTATCGGGCAATGTGGCGCACGGGGGTGGATCGGTTGATCTTGCTATTTTTTCTCTTCATTTGGCTGGTGTTTCTTCTATTTTAGGTGCTATTAATTTTATCACTACGGTCATTAATATGCGATGACGAGGGCTTCAATTTGAGCGTTTACCTTTATTTGTATGGTCTGTTAAAATTACTGCTATTTTGTTATTGTTATCGTTACCAGTTTTGGCTGGAGCGATTACTATGCTTCTTACTGATCGTAACTTTAACACTTCT | |||
Locus: | COI-5P | ||
Nucleotides: | 458 bp | ||
Sequence Upload Date: | 2019-06-01 |
Specimen Depository: | Centre for Biodiversity Genomics, Informatics Department |
---|---|
Sequencing Center: | Canadian Centre for DNA Barcoding |
Photography: | LifeScanner User |
Collectors: | Susan Wise-Eagle |
Specimen Identification: |
Process ID: | MOBIL9484-19 | Sample ID: | BOLD-3O6U17SL0 | |||
---|---|---|---|---|---|---|
Record Created: | 2019-04-29 | Museum ID: | ||||
Collection Code: | Field ID: | BOLD-3O6U17SL0 | ||||
Deposited In: | Centre for Biodiversity Genomics, Informatics Department | |||||
Associated Datasets: | DS-LSPUB | LifeScanner Samples Requested for Public Release | |||||
Specimen Linkout: | ||||||
Checksum: | 4f3bce735211a764ac671414b33357b8 |
Kingdom: | Animalia | Subfamily: | |
---|---|---|---|
Phylum: | Nemertea | Tribe: | |
Class: | Pilidiophora | Genus: | Maculaura |
Order: | Heteronemertea | Species: | Maculaura cerebrosa |
Family: | Lineidae | Scientific Name Authorship: | |
BIN ID: | BOLD:AAP1201 | Subspecies: | |
Identification Method: | |||
Taxonomy Notes: | |||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Reproduction: | ||
---|---|---|---|
Tissue Descriptor: | Sex: | ||
Brief Note: | Life Stage: | ||
Detailed Notes: | other: I think it`s Tubulanus polymorphus, though it is more pale flesh-colored than red |
Country/Ocean: | United States (US) | Collection Date Start: | |
---|---|---|---|
Province/State: | Alaska | Collection Date End: | |
Region/County: | Wrangell | Coord. Source: | |
Sector: | Coord. Accuracy: | ||
Exact Site: | Elevation: | ||
Habitat: | marine | Elevation Accuracy: | |
Latitude: | 56.356033 | Depth: | |
Longitude: | -132.35263 | Depth Accuracy: | |
Sampling Protocol: | |||
Collectors: | Susan Wise-Eagle | ||
Collection Note: |
Realm: | Nearctic |
---|---|
Biome: | |
Ecoregion: | Northern_Pacific_Alaskan_coastal_forests |
http://portal.boldsystems.org/record/MOBIL9484-19 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AMOBIL9484-19&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AMOBIL9484-19&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfL1d_L0sTSxMNE1tLTOyczNLElNAQDRCwuH?length=1
© 2024 BOLDSYSTEMS