| Sequence ID: | NEPTA338-13.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Naturalis Biodiversity Center | ||
| ACGATTAAATAATATAAGATTTTGATTATTACCACCTTCTTTAACGCTACTAATTTCGAGAAGAATTGTTGAAAATGGAGTAGGGACAGGATGAACAGTTTATCCCCCCCTATCTGCAAATATTGCCCACAGAGGAGGATCAGTAGATCTAGCTATTTTTTCATTACATTTAGCCGGTATTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTGTAATTAATATACGAGCTAATGGTATATCATTTGACCAAATACCTTTATTTGTTTGAGCTGTTGCTATTACCGCTTTATTATTATTATTATCATTGCCAGTATTAGCCGGAGCTATTACCATATTATTAACAGATCGAAATCTAAATACTTCTTTTTTTGACCCCGCAGGAGGTGGTGATCCTATTTTATACCAACAYTTATTCTGAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 425 bp | ||
| Sequence Upload Date: | 2013-07-23 | ||
| Specimen Depository: | Naturalis Biodiversity Center |
|---|---|
| Sequencing Center: | Naturalis Biodiversity Center |
| Photography: | C. van den Berg |
| Collectors: | G. Baldizzone |
| Specimen Identification: | Erik J. van Nieukerken |
| Process ID: | NEPTA338-13 | Sample ID: | RMNH.INS.23551 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2013-07-18 | Museum ID: | RMNH.INS.23551 | |||
| Collection Code: | Field ID: | |||||
| Deposited In: | Naturalis Biodiversity Center | |||||
| Associated Datasets: | DS-NEPCAT | Lepidoptera - Nepticuloidea of the World 2016 | |||||
| Specimen Linkout: | ||||||
| Checksum: | 02340b898e64b17cf483f9125ee5cb97 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Simplimorpha |
| Order: | Lepidoptera | Species: | Simplimorpha promissa |
| Family: | Nepticulidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAU3233 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | F | |
| Brief Note: | Life Stage: | adult | |
| Detailed Notes: | |||
| Country/Ocean: | Croatia (HR) | Collection Date Start: | 1990-07-30 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Krk | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Str. Krk-Vrbnik | Elevation: | 180 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 45.054 | Depth: | |
| Longitude: | 14.644 | Depth Accuracy: | |
| Sampling Protocol: | at light | ||
| Collectors: | G. Baldizzone | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Tyrrhenian-Adriatic_sclerophyllous_and_mixed_forests |
http://portal.boldsystems.org/record/NEPTA338-13 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ANEPTA338-13&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ANEPTA338-13&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfJzDQhxNDa20DU0ts7JzM0sSU0BAMbDC0s=?length=1
© 2024 BOLDSYSTEMS