| Sequence ID: | OPPNQ1343-17.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| GACTTTGTACTTAGTTTTTGGGGCATGAGCCGCTATGGTAGGGACAGCAATAAGTGTATTGATTCGAATTGAATTAGGTCAGCCTGGGAGATTTATTGGAGATGATCAACTTTATAATGTTATTGTAACTGCGCATGCGTTTGTAATAATTTTTTTTATAGTTATACCTATTTTAATTGGGGGATTTGGAAATTGATTAGTGCCTTTAATGTTAGGGGCTCCTGATATAGCGTTTCCTCGAATAAATAATTTAAGATTTTGATTACTTCCTCCATCTTTATTTCTTTTGATTGTTTCTTCAATAGTTGAGATAGGAGTTGGTGCAGGGTGGACTGTATATCCTCCTTTAGCCGGATTAGAGGGTCATGCTGGAAGATCAGTGGATTTTGCAATTTTTTCTTTGCATTTAGCGGGGGCTTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTATTAATATGCGTTTTTATGGAATAACAATAGAAAAAGTTCCTTTATTTGTGTGGTCTGTATTAATTACGGCTGTTTTACTATTACTTTCTTTACCCGTTTTGGCAGGTGCTATTACTATATTATTAACTGACCGAAATTTTAATACATCATTTTTTGATCCTTCGGGAGGGGGAGATCCTATTTTATTTCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2017-09-14 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | |
| Collectors: | CBG Collections Staff |
| Specimen Identification: | BOLD Identification System [2017] |
| Process ID: | OPPNQ1343-17 | Sample ID: | BIOUG35278-H10 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2017-07-24 | Museum ID: | BIOUG35278-H10 | |||
| Collection Code: | BIOUG | Field ID: | GMP#03729 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: | DS-OPPMP | Ontario Provincial Parks Malaise Program 2014 | |||||
| Specimen Linkout: | ||||||
| Checksum: | 51abe8689794b8d81d42f9fd30b60294 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Arachnida | Genus: | Araneus |
| Order: | Araneae | Species: | Araneus diadematus |
| Family: | Araneidae | Scientific Name Authorship: | Clerck, 1757 |
| BIN ID: | BOLD:AAA4125 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | Tissue | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2014-07-31 |
|---|---|---|---|
| Province/State: | Ontario | Collection Date End: | 2014-08-14 |
| Region/County: | Picton | Coord. Source: | |
| Sector: | Sandbanks Provincial Park | Coord. Accuracy: | |
| Exact Site: | Elevation: | 80 | |
| Habitat: | Forest | Elevation Accuracy: | |
| Latitude: | 43.90287 | Depth: | |
| Longitude: | -77.26929 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | CBG Collections Staff | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Eastern_Great_Lakes_lowland_forests |
http://portal.boldsystems.org/record/OPPNQ1343-17 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AOPPNQ1343-17&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AOPPNQ1343-17&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfIPCPALNDQ2MdY1NLfOyczNLElNAQDSDwuS?length=1
© 2024 BOLDSYSTEMS