| Sequence ID: | PHDLV195-22.COI-5P | GenBank Accession: | Pending (#9989) |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| CTTATATTTTATTTTTGGGGCATGGGCTAGAATAGTTGGAACTTCACTAAGATTATTAATTCGATCAGAATTAGGAAGACCTGGATCTTTAATTGGTGATGATCAAATTTATAATGTTATTGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATCATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCTCCAGACATAGCCTTCCCCCGAATAAATAACATAAGATTTTGACTTTTACCGCCCTCTCTTACTCTTTTAATTATAAGAAGAATTGTTGAAAATGGAGCAGGGACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCATAGAGGAGCTTCTGTAGATTTGGCTATTTTTAGTTTACATTTAGCCGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACAACAGTAATTAATATACGTCCTAGAGGAATAACTTTAGATCGCATACCTTTATTTGTATGAGCAGTAGTAATTACTGCTATTTTACTTTTATTATCCCTACCTGTTTTAGCTGGTGCAATTACGATACTTTTAACAGATCGTAATTTAAATACTTCATTTTTTGATCCAGCCGGAGGAGGAGATCCAATTTTATATCAACATTTAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 653 bp | ||
| Sequence Upload Date: | 2022-03-15 | ||
| Specimen Depository: | Institut National de la Recherche Agronomique, Zoologie Forestiere |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | Loïs Veillat |
| Collectors: | Hugo Mas |
| Specimen Identification: | Alain Roques |
| Process ID: | PHDLV195-22 | Sample ID: | LVHOMED179 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-01-24 | Museum ID: | ||||
| Collection Code: | 357 | Field ID: | LVHOMED179 | |||
| Deposited In: | Institut National de la Recherche Agronomique, Zoologie Forestiere | |||||
| Associated Datasets: | DS-EUROCERA | Barcodes of Cerambycidae species detected in Europe | |||||
| Specimen Linkout: | ||||||
| Checksum: | 41e0007f1846f799b607f2a1265e88c4 | |||||
| Kingdom: | Animalia | Subfamily: | Spondylidinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Asemini |
| Class: | Insecta | Genus: | Cephalocrius |
| Order: | Coleoptera | Species: | Cephalocrius syriacus |
| Family: | Cerambycidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:ACT2338 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | leg | Sex: | |
| Brief Note: | Life Stage: | Adult | |
| Detailed Notes: | |||
| Country/Ocean: | Spain (ES) | Collection Date Start: | 2021-01-01 |
|---|---|---|---|
| Province/State: | Comunidad Valenciana | Collection Date End: | |
| Region/County: | Provincia de Valencia | Coord. Source: | |
| Sector: | Sagunt | Coord. Accuracy: | |
| Exact Site: | Sagunt port | Elevation: | 3 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 39.652 | Depth: | |
| Longitude: | -0.221 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Hugo Mas | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Mediterranean_Forest_Woodlands_&_Scrub_simplify-0.001_buffered-0.018 |
| Ecoregion: | Northeast_Spain_and_Southern_France_Mediterranean_forests |
http://portal.boldsystems.org/record/PHDLV195-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3APHDLV195-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3APHDLV195-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQrwcPEJM7Q01TUyss7JzM0sSU0BAMcdC1I=?length=1
© 2024 BOLDSYSTEMS