| Sequence ID: | PLUME201-13.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Naturalis Biodiversity Center | ||
| AACATTATATTTTATTTTTGGAATTTGATCAGGAATATTAGGAACTTCTTTAAGTATATTAATTCGAGCTGAATTAGGAAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTCACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTATTCCACTAATAATAGGAGCCCCTGATATAGCTTTCCCTCGTATAAATAATATAAGTTTTTGATTATTACCCCCCTCTATTTTATTACTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACTGGATGAACAGTTTATCCCCCCCTCTCCTCTAATTTAACTCATAGAGGAAGATCTGTTGATTTAGCAATTTTCTCCCTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACCACTATTTTTAATATACGATTAAATAATATAATATTTGATCAAATACCTTTATTTATTTGAGCTGTCGGAATTACAGCTGTATTATTACTTTTATCCTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACAGATCGTAATCTAAATACTTCCTTTTTTGATCCTGCTGGTGGAGGAGATCCCATTCTTTACCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2013-04-05 | ||
| Specimen Depository: | Naturalis Biodiversity Center |
|---|---|
| Sequencing Center: | Naturalis Biodiversity Center |
| Photography: | Naturalis DNA barcoding facility |
| Collectors: | A. Cox |
| Specimen Identification: | Cees Gielis |
| Process ID: | PLUME201-13 | Sample ID: | RMNH.INS.550242 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2013-04-03 | Museum ID: | RMNH.INS.550242 | |||
| Collection Code: | INS | Field ID: | ||||
| Deposited In: | Naturalis Biodiversity Center | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 24d20047ae46c8e8daa44c0ed0b0308e | |||||
| Kingdom: | Animalia | Subfamily: | Agdistinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Agdistis |
| Order: | Lepidoptera | Species: | Agdistis glaseri |
| Family: | Pterophoridae | Scientific Name Authorship: | Arenberger, 1977 |
| BIN ID: | BOLD:ACD9608 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | Adult | |
| Detailed Notes: | Coll. C. Gielis Nr. 24343 | ||
| Country/Ocean: | Spain (ES) | Collection Date Start: | 2012-10-17 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Coord. Source: | Coordinates from country centroid | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Almeria Cabo de Gata | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 40.36501 | Depth: | |
| Longitude: | -3.6516252 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | A. Cox | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Iberian_sclerophyllous_and_semi-deciduous_forests |
http://portal.boldsystems.org/record/PLUME201-13 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3APLUME201-13&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3APLUME201-13&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQrwCfV1NTIw1DU0ts7JzM0sSU0BAMb_C0s=?length=1
© 2024 BOLDSYSTEMS