| Sequence ID: | SDHD630-09.COI-5P | GenBank Accession: | OQ274084 |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Museum National d'Histoire Naturelle, Service de Systematique Moleculaire | ||
| TAAGTTTTTGACTCCTCCCCCCCTCTCTAACTTTATTAATTTCGAGAAGAGTTGTCGAAAATGGAGCTGGAACTGGATGAACTGTATACCCCCCCCTTTCTTCTAATATTGCTCACAGAGGGTCTTCTGTCGATTTAGCTATTTTTTCTCTACATTTAGCGGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGATTGAATAATATAACTTTCGACCAAATACCCCTATTCGTTTGATCTGTTGGAATTACAGCTTTTCTTCTCCTCCTCTCTCTCCCTGTATTAGCAGGAGCCATTACAATACTTTTAACAGATCGTAATCTCAATACTTCCTTTTTTGATCCTGCTGGAGGAGGAGACCCTATTTTATACCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 407 bp | ||
| Sequence Upload Date: | 2018-02-18 | ||
| Specimen Depository: | Research Collection of Daniel Herbin |
|---|---|
| Sequencing Center: | Museum National d'Histoire Naturelle, Service de Systematique Moleculaire |
| Photography: | Daniel Herbin |
| Collectors: | R. Lichy |
| Specimen Identification: | Daniel Herbin |
| Process ID: | SDHD630-09 | Sample ID: | BC-Her3630 | |||
|---|---|---|---|---|---|---|
| Record Created: | Museum ID: | BC-Her3630 | ||||
| Collection Code: | Field ID: | BC-Her3630 | ||||
| Deposited In: | Research Collection of Daniel Herbin | |||||
| Associated Datasets: |
DS-LONO2 | Lonomia records used in Gonzalez et al. "Deadly and venomous Lonomia caterpillars are more than the two usual suspects." DS-SATYP1 | Primary types of Saturniidae species |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 1fbe4ffcd1551051e2edfbcf5c282f6c | |||||
| Kingdom: | Animalia | Subfamily: | Hemileucinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Hemileucini |
| Class: | Insecta | Genus: | Lonomia |
| Order: | Lepidoptera | Species: | Lonomia camox |
| Family: | Saturniidae | Scientific Name Authorship: | Lemaire, 1971 |
| BIN ID: | BOLD:AAE0724 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Holotype of Lonomia camox | Reproduction: | S |
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | Adult | |
| Detailed Notes: | |||
| Country/Ocean: | Venezuela (VE) | Collection Date Start: | 1957-12-03 |
|---|---|---|---|
| Province/State: | Bolivar | Collection Date End: | |
| Region/County: | Coord. Source: | Google Earth | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | El Dorado to Santa Elena Km 109 | Elevation: | 480 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 5.96561 | Depth: | |
| Longitude: | -61.39488 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | R. Lichy | ||
| Collection Note: | |||
| Realm: | Neotropic |
|---|---|
| Biome: | |
| Ecoregion: | Guianan_piedmont_moist_forests |
http://portal.boldsystems.org/record/SDHD630-09 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ASDHD630-09&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ASDHD630-09&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQp28XAxMzbQNbC0zsnMzSxJTQEAuwsK9g==?length=1
© 2024 BOLDSYSTEMS