| Sequence ID: | STPAL019-20.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | jgLCO1490 (GMATAGTAGGMACRGCYCTNA) | Primers Reverse: | jgHCO2198 (YCCTGTGAATAGGGGGAATC) |
| Sequence Run Site: | Smithsonian Institution, National Museum of Natural History, Laboratories of Analytical Biology | ||
| TACGCTTTATTTTATATTAGGTGTATGGGCCGCTTTTTTTGGTACCTCTTTAAGAATAATTATCCGGACAGAGCTTATAACACCGGGTAATGTTATTGGTGATGACCAAATTTATAATGTTATTGTTACAGCCCACGCCTTTGTTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGTTTTGGTAACTGACTAGTCCCTTTAATACTAGGAAGCCCTGATATGGCCTTTCCTCGAATAAACAACATAAGATTTTGGTTATTGCCCCCTTCTCTCACTCTTCTGATCGTTAGAGGGATAGTGGAAAGAGGTGTGGGTACTGGTTGGACAGTCTACCCCCCTTTAAGGTCTAGGTCTGGGCACCCTGGGGGTGCCGTGGACCTAGCTATTTTTTCTTTACACCTGGCAGGTGCTAGATCTATTTTGGGGGCTATTAATTTTATCTCTACTATTATTAATATGCGGGCAGACGCTATATACTTTGACCGAATACCTTTATTCGTGTGATCCGTTTTTATCACTGCTATTTTACTATTGTTATCATTACCTGTTTTAGCCGGGGCTATTACTATGTTACTAACAGACCGAAACCTGAACACCTCTTTCTTCGACCCTTTGGGAGGGGGGGACCCTATTTTATACCAACACTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2020-04-07 | ||
| Specimen Depository: | Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoology |
|---|---|
| Sequencing Center: | Smithsonian Institution, National Museum of Natural History, Laboratories of Analytical Biology |
| Photography: | |
| Collectors: | Gail Ashton|Katie Newcomer|Linda Shaw|Barbara Lake |
| Specimen Identification: | Gail Ashton |
| Process ID: | STPAL019-20 | Sample ID: | 273903 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2020-02-25 | Museum ID: | ||||
| Collection Code: | Field ID: | 273903 | ||||
| Deposited In: | Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoology | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 701a85f848be37f3ed22f35989b5a4c1 | |||||
| Kingdom: | Animalia | Subfamily: | Caprellinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Malacostraca | Genus: | Caprella |
| Order: | Amphipoda | Species: | Caprella equilibra |
| Family: | Caprellidae | Scientific Name Authorship: | Say, 1818 |
| BIN ID: | BOLD:AEC7312 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | Caprella equilibra m | ||
| Country/Ocean: | United States (US) | Collection Date Start: | 2019-09-16 |
|---|---|---|---|
| Province/State: | Alaska | Collection Date End: | |
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Fishing Dock | Elevation: | |
| Habitat: | intertidal zone | Elevation Accuracy: | |
| Latitude: | 57.124 | Depth: | |
| Longitude: | -170.279 | Depth Accuracy: | |
| Sampling Protocol: | By hand | ||
| Collectors: | Gail Ashton|Katie Newcomer|Linda Shaw|Barbara Lake | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Aleutian_Islands_tundra |
http://portal.boldsystems.org/record/STPAL019-20 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ASTPAL019-20&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ASTPAL019-20&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQoOCXD0MTC01DUysM7JzM0sSU0BAMdcC1E=?length=1
© 2024 BOLDSYSTEMS