Collection Site(s)



Legend
1+
10+
100+
1000+
10000+

Sequence: rbcLa

Sequence ID: SZUAB009-24.rbcLa GenBank Accession:
Primers Forward: rbcLa-F (ATGTCACCACAAACAGAGACTAAAGC) Primers Reverse: rbcL-aar (CTTCTGCTACAAATAAGAATCGATCTC)
Sequence Run Site: University of Salzburg
AGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCTCTATTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCCCAACCGTTTATGCGTTGGAGAGAA
Locus: rbcLa
Nucleotides: 634 bp
Sequence Upload Date: 2024-12-06

Attribution

Specimen Depository: University of Salzburg
Sequencing Center: University of Salzburg
Photography:
Collectors: Andreas Tribsch
Specimen Identification: Andreas Tribsch

Identifiers

Process ID: SZUAB009-24 Sample ID: SZU50090004_01
Record Created: 2024-12-04 Museum ID: SZU50090004
Collection Code: SZU Field ID: 112126
Deposited In: University of Salzburg
Associated Datasets:
Specimen Linkout:
Checksum: 2eaa9ddbc0736c68ace2bf93911772b0

Taxonomy

Kingdom: Plantae Subfamily: Brassicoideae
Phylum: Tracheophyta Tribe:
Class: Magnoliopsida Genus: Braya
Order: Brassicales Species: Braya alpina
Family: Brassicaceae Scientific Name Authorship:
BIN ID: Subspecies:
Identification Method:
Taxonomy Notes:
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings

Specimen

Voucher Status: herbarium voucher Reproduction:
Tissue Descriptor: silica collection Sex:
Brief Note: Life Stage:
Detailed Notes:

Collection

Country/Ocean: Italy (IT) Collection Date Start: 2011-07-27
Province/State: South Tyrol Collection Date End:
Region/County: Zillertaler Alpen Coord. Source:
Sector: Coord. Accuracy: 700
Exact Site: Finsterstern/Ochsenalmspitze (W Kramerspitze) Elevation: 2640
Habitat: calcareous schist, scree Elevation Accuracy:
Latitude: 46.90889 Depth:
Longitude: 11.559722 Depth Accuracy:
Sampling Protocol:
Collectors: Andreas Tribsch
Collection Note:

Ecology

Realm:
Biome:
Ecoregion:

Publications

Electropherogram Trace Files

Under development - available shortly

Controller URLs

http://portal.boldsystems.org/record/SZUAB009-24
http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ASZUAB009-24&fields=marker_code
http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ASZUAB009-24&extent=limited
http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQqOCnV0MjCw1DUysc7JzM0sSU0BAMeeC1U=?length=1

AJAX URLs


                

© 2024 BOLDSYSTEMS