| Sequence ID: | TBGMI125-21.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Novogene, Nanjing | ||
| ATATACCTAATCTTCGGCACTTGGGCCGCAATAGCAGGCACAGCCCTAAGCCTAATCGTACGCCTAGAACTAAGACAACCAGGAACCCTTATTGGGGACGACCAAATCTACAACGTAATCGTAACCGCTCACGCCTTTGTAATAATCTTCTTCATGGTAATACCAATTATAATAGGAGGATTCGGAAACTGAATACTTCCATTAATATTAGGGGCACCAGACATAGCCTTTCCCCGAATAAACAACCTTAGATTCTGACTACTACCCCCCTCCCTCACCCTCTTAATAACCTCAATAGCAGTAGAAAGAGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTAGCCGCTAACATCTCCCACTCTGGCCCATCAGTAGACATAACAATTTTCTCTCTACACCTTGCCGGAGTATCCTCCATCCTAGCCTCTATTAACTTCATCACTACAATTATTAACATACGAGCAAGAGGAATAGTTTTAGAACGAATCCCCCTATTCGTTTGAAGCGTAAAAATTACAGCAGTCCTCCTTCTACTCTCTCTCCCCGTCTTAGCCGGAGCAATCACAATGCTTCTAACAGACCGAAATATTAATACAAGCTTCTTCGACCCGGCAGGAGGAGGAGACCCAATTTTATACCAACACTTATTTTGATTCTTCGGACACCCAGAAGTATA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 680 bp | ||
| Sequence Upload Date: | 2021-07-15 | ||
| Specimen Depository: | Senckenberg Museum of Natural History Goerlitz |
|---|---|
| Sequencing Center: | Novogene, Nanjing |
| Photography: | |
| Collectors: | |
| Specimen Identification: | Peter Decker |
| Process ID: | TBGMI125-21 | Sample ID: | TBGMI-Gr-Myr-00805 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2021-05-04 | Museum ID: | Gr-Myr-00805 | |||
| Collection Code: | Field ID: | a96 | ||||
| Deposited In: | Senckenberg Museum of Natural History Goerlitz | |||||
| Associated Datasets: | DS-TBGMI | Soil invertebrates from the LOEWE TBG and Senckenberg project: 'Metagenomic monitoring of soil communities' (MetaInvert) | |||||
| Specimen Linkout: | ||||||
| Checksum: | 9c0897a3cbc67040e83a962e91546111 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Chilopoda | Genus: | Geophilus |
| Order: | Geophilomorpha | Species: | Geophilus truncorum |
| Family: | Geophilidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAZ2183 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | SAMN25040797 | ||
| Country/Ocean: | Germany (DE) | Collection Date Start: | 2013-10-16 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Mueritz National Park | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Neustrelitz, Praelank | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 53.36691 | Depth: | |
| Longitude: | 12.98455 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | |||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Temperate_Broadleaf_&_Mixed_Forest_simplify-0.001_buffered-0.018 |
| Ecoregion: | Baltic_mixed_forests |
http://portal.boldsystems.org/record/TBGMI125-21 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ATBGMI125-21&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ATBGMI125-21&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQpxcvf1NDQy1TUytM7JzM0sSU0BAMYZCz8=?length=1
© 2024 BOLDSYSTEMS