| Sequence ID: | TLAMP414-17.COI-5P | GenBank Accession: | MF629700 |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG, LCO1490:GGTCAACAAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA, HCO2198:TAAACTTCAGGGTGACCAAAAAATCA) |
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| AACCCTTTATTTTGTTTTAGGAGCTTGAGCTAGAGTGGTGGGAACTTCTATAAGCTTGATTATTCGCTCAGAATTAAGTGCCCCGGGAAATTTAATTGGAGATGATCAATTATACAATGTAATAGTTACCGCACACGCATTTGTTATGATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAATCCCCTTAATATTAGGGAGGCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTCTGGTTACTACCCCCATCCCTCACTCTCCTTCTTTTAAGCTCCTTAGTAGAAAGTGGAGCTGGTACAGGCTGAACTGTCTATCCGCCTCTCTCTAACTCTATAGGCCATAGCGGCGCATCAGTAGATTTAGCTATTTTCTCCCTCCATTTAGCGGGAGCATCATCTATCCTTGGAGCAATTAATTTTATTTCTACAATTCTTAATATGCGGGCTCCTGGCATATCCATAGACCAAATACCTTTATTTGTGTGATCAGTATTTATCACAGCTATCTTGCTTCTCCTGTCCTTACCAGTTTTAGCTGGGGCTATCACTATATTATTAACTGACCGCAATCTAAATACATCTTTCTTTGACCCTAGGGGTGGTGGAGACCCAATCTTATATCAACACTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2017-01-26 | ||
| Specimen Depository: | National Academy of Sciences of Belarus, Scientific and Practical Center for Bioresources |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | Tatsiana Lipinskaya |
| Collectors: | T.P.Lipinskaya |
| Specimen Identification: | Tatsiana Lipinskaya |
| Process ID: | TLAMP414-17 | Sample ID: | SPCB-EI016 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2017-01-18 | Museum ID: | ||||
| Collection Code: | SPCB | Field ID: | 16-05-09_NIZ-EI | |||
| Deposited In: | National Academy of Sciences of Belarus, Scientific and Practical Center for Bioresources | |||||
| Associated Datasets: |
DS-BELCRUST | Echinogammarus from Belarus DS-DCTRICH | Trichogammarus trichiatus story DS-HACK2019 | Marine hackathon Norway 2019 DS-HACKAMP | Marine hackathon - Amphipods DS-L3GL | Great Lakes DNA barcode Level 3 database DS-NISEURC | Assemble and audit of a DNA barcode reference library for marine invertebrate NIS occurring in European Coastal Regions - Grade C records |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 3b4b8d897f378719b77d00e3f8b3a0a3 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Malacostraca | Genus: | Chaetogammarus |
| Order: | Amphipoda | Species: | Chaetogammarus ischnus |
| Family: | Gammaridae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAB7817 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | formerly: Echinogammarus ischnus | ||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | a | |
| Detailed Notes: | 5m dredge 9 | ||
| Country/Ocean: | Belarus (BY) | Collection Date Start: | 2016-05-09 |
|---|---|---|---|
| Province/State: | Homyel Voblasc | Collection Date End: | |
| Region/County: | Bragin district | Coord. Source: | GPS WGS84 |
| Sector: | Nizhnie Zhary vill. | Coord. Accuracy: | |
| Exact Site: | Dniepr River | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 51.2946 | Depth: | |
| Longitude: | 30.5725 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | T.P.Lipinskaya | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Central_European_mixed_forests |
http://portal.boldsystems.org/record/TLAMP414-17 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ATLAMP414-17&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ATLAMP414-17&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQrxcfQNMDE00TU0t87JzM0sSU0BAMcNC1A=?length=1
© 2024 BOLDSYSTEMS