| Sequence ID: | TTCFW843-08.COI-5P | GenBank Accession: | MG477998 |
|---|---|---|---|
| Primers Forward: | LCO1490_t1 (TGTAAAACGACGGCCAGTGGTCAACAAATCATAAAGATATTGG) MLepF1 (GCTTTCCCACGAATAAATAATA) | Primers Reverse: | HCO2198_t1 (CAGGAAACAGCTATGACTAAACTTCAGGGTGACCAAAAAATCA) MLepR1 (CCTGTTCCAGCTCCATTTTC) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TAAGATTCTGGCTACTCCCTCCCTCTTTAACATTACTTTTAATAAGAAGAATAGTCGAAAGAGGAGCAGGGACTGGTTGGACAGTATATCCACCATTAGCGGCTAATATTGCCCATAGAGGGGGCTCTGTTGACTTAGCAATTTTTAGACTTCATTTAGCTGGAATCTCCTCAATTCTAGGGGCAATTAATTTTATTACAACAGTAATTAATATGCGAGCAATAGGAATAACCTTAGACCAAACACCTCTACTAGTCTGATCTATTGCTATTACAGCCCTTCTTCTTCTTTTATCCTTACCTGTTCTTGCGGGAGCAATTACCATACTTTTAACAGATCGAAACTTAAATACATCATTCTTTGACCCGGCTGGAGGAGGAGACCCTATTCTTTATCAACATCTCTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 406 bp | ||
| Sequence Upload Date: | 2010-01-22 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | CBG Photography Group |
| Collectors: | Miles Zhang |
| Specimen Identification: |
| Process ID: | TTCFW843-08 | Sample ID: | 08MZPP-004 | |||
|---|---|---|---|---|---|---|
| Record Created: | Museum ID: | |||||
| Collection Code: | Field ID: | 08MZPP-004 | ||||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: |
DATASET-BBPPNP1 | BIObus - Point Pelee National Park DS-17CNP24 | Canadian National Parks Data Release 24 DS-BFNWARN | Bundesamt fuer Naturschutz Warnliste, Arthropoden DS-VGDS010 | 759 Agrilus DS-ZIGB024 | iBOL Records Genbank Submission 024 |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 9b0a3c5ee199ef8b5b0ff9bbca07610a | |||||
| Kingdom: | Animalia | Subfamily: | Agrilinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Agrilini |
| Class: | Insecta | Genus: | Agrilus |
| Order: | Coleoptera | Species: | Agrilus planipennis |
| Family: | Buprestidae | Scientific Name Authorship: | Fairmaire, 1888 |
| BIN ID: | BOLD:AAE6821 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2008-07-10 |
|---|---|---|---|
| Province/State: | Ontario | Collection Date End: | |
| Region/County: | Point Pelee | Coord. Source: | |
| Sector: | Point Pelee National Park | Coord. Accuracy: | |
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 41.683 | Depth: | |
| Longitude: | -82.683 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Miles Zhang | ||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/TTCFW843-08 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ATTCFW843-08&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ATTCFW843-08&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsQoJcXYLtzAx1jWwsM7JzM0sSU0BAMgKC2A=?length=1
© 2024 BOLDSYSTEMS