| Sequence ID: | YIOB076-15.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | L6697Bird (TCAACYAACCACAAAGAYATCGGYAC) | Primers Reverse: | H7390Thrush (ACGTGGGARATRATTCCAAATCCTG) |
| Sequence Run Site: | Yamashina Institute for Ornithology | ||
| AAGANATCGGTACCCTATACCTGATCTTCGGCGCATGAGCTGGTATAGTTGGAACTGCCCTCAGCCTACTTATTCGAGCAGAACTAGGTCAACCCGGAACCCTCTTAGGAGATGACCAAATCTACAATGTGATTGTCACCGCCCACGCCTTTGTGATAATCTTCTTCATAGTAATACCAATTATAATCGGTGGCTTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCAGACATAGCATTCCCTCGTATAAACAACATGAGCTTCTGACTACTCCCTCCATCATTCCTACTACTACTAGCATCATCCACAGTAGAAGCCGGAGCAGGTACAGGATGAACAGTGTATCCCCCACTCGCCGGTAACCTAGCACATGCTGGAGCTTCCGTAGACCTCGCCATCTTCTCCCTCCACCTGGCAGGTGTCTCCTCCATTCTAGGTGCCATCAACTTTATCACAACTGCCATCAACATAAAACCTCCAGCTCTCTCCCAATACCAAACACCCCTATTCGTATGATCAGTACTTATTACCGCCGTCTTACTCCTACTCTCCCTTCCAGTCCTTGCTGCTGGCATTACCATACTACTAACAGACCGAAACCTAAACACTACATTCTTTGATCCTGCTGGAGGAGGAGACCCGGTCCTATATCAACACCTATTCTGATTCTTCGGCCATCCAGAGGTCTACATCCTAATCTTACCAGGATTTGG | |||
| Locus: | COI-5P | ||
| Nucleotides: | 718 bp | ||
| Sequence Upload Date: | 2015-08-31 | ||
| Specimen Depository: | Yamashina Institute for Ornithology |
|---|---|
| Sequencing Center: | Yamashina Institute for Ornithology |
| Photography: | |
| Collectors: | Y. Shigeta |
| Specimen Identification: | Takema Saitoh |
| Process ID: | YIOB076-15 | Sample ID: | 2011-1116 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2015-08-25 | Museum ID: | ||||
| Collection Code: | Field ID: | 2011-1116 | ||||
| Deposited In: | Yamashina Institute for Ornithology | |||||
| Associated Datasets: | DS-IUCNPUB | IUCN Red List Public DNA barcode reference library 2024 | |||||
| Specimen Linkout: | ||||||
| Checksum: | 7ce34f0632fdd05ae1efa2efcf692fc9 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Chordata | Tribe: | |
| Class: | Aves | Genus: | Calidris |
| Order: | Charadriiformes | Species: | Calidris falcinellus |
| Family: | Scolopacidae | Scientific Name Authorship: | (Pontoppidan, 1763) |
| BIN ID: | BOLD:AAD0086 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Japan (JP) | Collection Date Start: | 2011-09-05 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Chiba | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 35.674 | Depth: | |
| Longitude: | 140.005 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Y. Shigeta | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Taiheiyo_evergreen_forests |
http://portal.boldsystems.org/record/YIOB076-15 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AYIOB076-15&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AYIOB076-15&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsYr09HcyMDfTNTS1zsnMzSxJTQEAvCwLBw==?length=1
© 2024 BOLDSYSTEMS